ID: 1125442060_1125442063

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1125442060 1125442063
Species Human (GRCh38) Human (GRCh38)
Location 15:39713786-39713808 15:39713821-39713843
Sequence CCAACTTCTGTAATCATTTGGGA CAGTGAAAACAGCTGGAGCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 177} {0: 1, 1: 0, 2: 5, 3: 41, 4: 446}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!