ID: 1125462460_1125462469

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1125462460 1125462469
Species Human (GRCh38) Human (GRCh38)
Location 15:39920158-39920180 15:39920179-39920201
Sequence CCCTCACGTCTCCACATCGCCAA AACCCCGGCGCCCGGGAGGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 78} {0: 1, 1: 0, 2: 2, 3: 11, 4: 189}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!