ID: 1125466549_1125466557

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1125466549 1125466557
Species Human (GRCh38) Human (GRCh38)
Location 15:39958787-39958809 15:39958821-39958843
Sequence CCCTCCTGCCCCAACATCTACAC TGGTAGAGCAATCTTTTGGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 30, 4: 337} {0: 1, 1: 0, 2: 2, 3: 9, 4: 127}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!