ID: 1125485591_1125485604

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1125485591 1125485604
Species Human (GRCh38) Human (GRCh38)
Location 15:40108772-40108794 15:40108812-40108834
Sequence CCGGGCTGCGGCAGGAGGCGGGA CGGCGGCGGCGGGCACAGGCCGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 3, 3: 26, 4: 370} {0: 1, 1: 0, 2: 10, 3: 69, 4: 595}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!