ID: 1125488998_1125489003

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1125488998 1125489003
Species Human (GRCh38) Human (GRCh38)
Location 15:40132704-40132726 15:40132719-40132741
Sequence CCCTGTGATATTGTTCCTAATAT CCTAATATCCAGCGGGAAACAGG
Strand - +
Off-target summary {0: 359, 1: 894, 2: 1568, 3: 1894, 4: 2199} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!