ID: 1125504271_1125504276

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1125504271 1125504276
Species Human (GRCh38) Human (GRCh38)
Location 15:40257939-40257961 15:40257958-40257980
Sequence CCTGTGGGTCGCCTGGCTTCAGG CAGGCTGAGCCCCTACAGAGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 241} {0: 1, 1: 0, 2: 1, 3: 21, 4: 183}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!