ID: 1125508771_1125508789

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1125508771 1125508789
Species Human (GRCh38) Human (GRCh38)
Location 15:40281983-40282005 15:40282031-40282053
Sequence CCGCGGGGGCCGGGCGGCCAGGG CCGCAGCGGCGGCGGCGGCGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 32, 4: 458} {0: 1, 1: 18, 2: 171, 3: 447, 4: 1354}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!