ID: 1125511828_1125511840

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1125511828 1125511840
Species Human (GRCh38) Human (GRCh38)
Location 15:40296377-40296399 15:40296408-40296430
Sequence CCAGGCCCGCTGTGCCCTAAGGA GAGGGCAAAGAAGAGGAGGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 125} {0: 1, 1: 0, 2: 29, 3: 266, 4: 2250}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!