ID: 1125512666_1125512673

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1125512666 1125512673
Species Human (GRCh38) Human (GRCh38)
Location 15:40301233-40301255 15:40301255-40301277
Sequence CCAAATTCTTACCAGGAGAAAAT TACTCCATGGGGTATAGGCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 31, 4: 314} {0: 1, 1: 0, 2: 0, 3: 5, 4: 92}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!