ID: 1125513235_1125513245

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1125513235 1125513245
Species Human (GRCh38) Human (GRCh38)
Location 15:40303878-40303900 15:40303916-40303938
Sequence CCACCCTTCCAGGCCATTCTGTA GCCTCCACCTTGGTGCAGCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 26, 4: 273} {0: 1, 1: 0, 2: 0, 3: 12, 4: 208}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!