ID: 1125515085_1125515093

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1125515085 1125515093
Species Human (GRCh38) Human (GRCh38)
Location 15:40314371-40314393 15:40314415-40314437
Sequence CCACTTTATAGAAGACACAGGTG TGGATGAGTCTTGTTCTCTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 16, 4: 215} {0: 1, 1: 0, 2: 2, 3: 22, 4: 199}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!