ID: 1125517804_1125517815

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1125517804 1125517815
Species Human (GRCh38) Human (GRCh38)
Location 15:40332506-40332528 15:40332543-40332565
Sequence CCTACTTCCCCACAGCCCTTCTG CTGCTTCAGTCCCATTGTGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 8, 3: 66, 4: 527} {0: 1, 1: 0, 2: 1, 3: 15, 4: 147}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!