ID: 1125591647_1125591651

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1125591647 1125591651
Species Human (GRCh38) Human (GRCh38)
Location 15:40857925-40857947 15:40857950-40857972
Sequence CCTGTTGAGTGGTTGAGCTCTCC AATTCTGCTCATTTGGAGGTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 59} {0: 1, 1: 0, 2: 2, 3: 16, 4: 186}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!