ID: 1125594270_1125594278

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1125594270 1125594278
Species Human (GRCh38) Human (GRCh38)
Location 15:40874170-40874192 15:40874211-40874233
Sequence CCCGGGTCTCGGCTTCGCTGCGC CTGGCTGCCTCTGACTGAATGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 78} {0: 1, 1: 0, 2: 2, 3: 41, 4: 172}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!