ID: 1125598579_1125598588

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1125598579 1125598588
Species Human (GRCh38) Human (GRCh38)
Location 15:40903085-40903107 15:40903128-40903150
Sequence CCTACAAGCAGGCCCGGCTGGAG GGCTGCTCCACCCCCAGCCAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 150} {0: 1, 1: 4, 2: 13, 3: 151, 4: 1294}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!