ID: 1125601941_1125601948

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1125601941 1125601948
Species Human (GRCh38) Human (GRCh38)
Location 15:40920163-40920185 15:40920192-40920214
Sequence CCTCCCTGCTCCAGACTACCCTG ACTGCCAGAAAGCATGCAGACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 30, 4: 325} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!