ID: 1125612588_1125612593

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1125612588 1125612593
Species Human (GRCh38) Human (GRCh38)
Location 15:40981923-40981945 15:40981950-40981972
Sequence CCAGTCCAAATCCTTCCTCATTC CCTCCCTTTTGAATACAGACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 32, 4: 319} {0: 1, 1: 0, 2: 0, 3: 17, 4: 160}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!