ID: 1125612589_1125612596

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1125612589 1125612596
Species Human (GRCh38) Human (GRCh38)
Location 15:40981928-40981950 15:40981965-40981987
Sequence CCAAATCCTTCCTCATTCTTCTC CAGACAGGCAACTTATCAGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 10, 3: 89, 4: 749} {0: 1, 1: 0, 2: 0, 3: 4, 4: 110}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!