ID: 1125612857_1125612863

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1125612857 1125612863
Species Human (GRCh38) Human (GRCh38)
Location 15:40983969-40983991 15:40983998-40984020
Sequence CCATGGCCTTGCACCCAGCTAGG CTTCACAGTTGAGGCTGCTTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 248} {0: 1, 1: 0, 2: 0, 3: 12, 4: 198}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!