ID: 1125626832_1125626845

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1125626832 1125626845
Species Human (GRCh38) Human (GRCh38)
Location 15:41115988-41116010 15:41116005-41116027
Sequence CCCGCCGCCGCGACGGCGGCGGA GGCGGAGGGGGGGCGGGGTGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 281} {0: 1, 1: 3, 2: 45, 3: 620, 4: 4589}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!