ID: 1125626832_1125626855

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1125626832 1125626855
Species Human (GRCh38) Human (GRCh38)
Location 15:41115988-41116010 15:41116023-41116045
Sequence CCCGCCGCCGCGACGGCGGCGGA TGCGGGCGGGGTCCGGAGGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 281} {0: 1, 1: 0, 2: 3, 3: 30, 4: 474}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!