ID: 1125626833_1125626859

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1125626833 1125626859
Species Human (GRCh38) Human (GRCh38)
Location 15:41115989-41116011 15:41116040-41116062
Sequence CCGCCGCCGCGACGGCGGCGGAG GGGGGGGGTCGCCCCGCCGACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 44, 4: 318} {0: 1, 1: 0, 2: 0, 3: 14, 4: 77}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!