ID: 1125626840_1125626860

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1125626840 1125626860
Species Human (GRCh38) Human (GRCh38)
Location 15:41115995-41116017 15:41116043-41116065
Sequence CCGCGACGGCGGCGGAGGGGGGG GGGGGTCGCCCCGCCGACGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 43, 4: 506} {0: 1, 1: 0, 2: 0, 3: 3, 4: 69}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!