ID: 1125630810_1125630813

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1125630810 1125630813
Species Human (GRCh38) Human (GRCh38)
Location 15:41145571-41145593 15:41145586-41145608
Sequence CCTAACAAATGATGCCCTTTCTT CCTTTCTTTTAGAAGAGTGAAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 2, 3: 31, 4: 307} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!