ID: 1125678850_1125678854

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1125678850 1125678854
Species Human (GRCh38) Human (GRCh38)
Location 15:41517972-41517994 15:41517996-41518018
Sequence CCTTCCTTCCTCTGAAGATGGAG TGTAACTTACTGAGCTCTGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 38, 4: 367} {0: 1, 1: 0, 2: 2, 3: 14, 4: 178}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!