ID: 1125681093_1125681100

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1125681093 1125681100
Species Human (GRCh38) Human (GRCh38)
Location 15:41530659-41530681 15:41530694-41530716
Sequence CCCCAGCACTGTGAGCAGAGAGA GGATGGACAGAGCCAGAGCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 65, 4: 340} {0: 1, 1: 0, 2: 2, 3: 37, 4: 430}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!