ID: 1125686908_1125686917

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1125686908 1125686917
Species Human (GRCh38) Human (GRCh38)
Location 15:41568838-41568860 15:41568875-41568897
Sequence CCCAGGCTCACTATGGGGTGGGG CAGGATGAGCTGACAGTGGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 29, 4: 231} {0: 1, 1: 1, 2: 2, 3: 23, 4: 254}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!