ID: 1125720012_1125720024

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1125720012 1125720024
Species Human (GRCh38) Human (GRCh38)
Location 15:41840806-41840828 15:41840856-41840878
Sequence CCTGGTGACCGGAGATGACCCTG CTCTGCGGGCTGGGGAGTTCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 147} {0: 1, 1: 1, 2: 1, 3: 24, 4: 214}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!