ID: 1125722222_1125722231

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1125722222 1125722231
Species Human (GRCh38) Human (GRCh38)
Location 15:41850828-41850850 15:41850849-41850871
Sequence CCCCGCATCCTTCCCCTGAAGCC CCCACCTGCAGTGCTGCCCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 30, 4: 311} {0: 1, 1: 0, 2: 6, 3: 34, 4: 376}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!