ID: 1125728851_1125728860

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1125728851 1125728860
Species Human (GRCh38) Human (GRCh38)
Location 15:41881918-41881940 15:41881939-41881961
Sequence CCCTGTCCCCGTCCTCACCGTGA GAATAACGACGCCCGGGCCGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 25, 3: 26, 4: 164} {0: 1, 1: 0, 2: 0, 3: 1, 4: 19}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!