ID: 1125734225_1125734233

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1125734225 1125734233
Species Human (GRCh38) Human (GRCh38)
Location 15:41912322-41912344 15:41912346-41912368
Sequence CCACCCGCGTCCTGCCCTTCCTG TGCGCCCTAAACAATAACCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 37, 4: 480} {0: 1, 1: 0, 2: 0, 3: 4, 4: 34}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!