ID: 1125744326_1125744333

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1125744326 1125744333
Species Human (GRCh38) Human (GRCh38)
Location 15:41988363-41988385 15:41988379-41988401
Sequence CCCTCCCCTCAGTGCCGGGAGAC GGGAGACGTAAAGGTGTATAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 168} {0: 1, 1: 0, 2: 0, 3: 3, 4: 81}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!