ID: 1125748084_1125748089

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1125748084 1125748089
Species Human (GRCh38) Human (GRCh38)
Location 15:42010980-42011002 15:42011006-42011028
Sequence CCCAGGACCTAAAAGACATCGGG GTCTTAATCTAACCCAGGCAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 83} {0: 1, 1: 0, 2: 0, 3: 13, 4: 126}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!