ID: 1125753443_1125753453

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1125753443 1125753453
Species Human (GRCh38) Human (GRCh38)
Location 15:42046075-42046097 15:42046120-42046142
Sequence CCAGAATCCATCCACTCCTACTG AAGCCACCTCCATTTCTCTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 174} {0: 1, 1: 1, 2: 5, 3: 28, 4: 256}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!