ID: 1125768117_1125768129

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1125768117 1125768129
Species Human (GRCh38) Human (GRCh38)
Location 15:42148517-42148539 15:42148564-42148586
Sequence CCCTCCACCTCCCCTTTCCCCAG CACATGGATGAATGTCCCCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 22, 3: 195, 4: 1860} {0: 1, 1: 0, 2: 0, 3: 19, 4: 185}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!