ID: 1125768117_1125768130

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1125768117 1125768130
Species Human (GRCh38) Human (GRCh38)
Location 15:42148517-42148539 15:42148565-42148587
Sequence CCCTCCACCTCCCCTTTCCCCAG ACATGGATGAATGTCCCCAGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 22, 3: 195, 4: 1860} {0: 1, 1: 0, 2: 3, 3: 25, 4: 218}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!