ID: 1125769632_1125769639

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1125769632 1125769639
Species Human (GRCh38) Human (GRCh38)
Location 15:42156493-42156515 15:42156529-42156551
Sequence CCCCAGGAGGGGCAGCATCTTGT TGGCCAGAGTGCCCAAAGCATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 18, 4: 192} {0: 1, 1: 0, 2: 3, 3: 28, 4: 244}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!