ID: 1125769634_1125769642

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1125769634 1125769642
Species Human (GRCh38) Human (GRCh38)
Location 15:42156495-42156517 15:42156534-42156556
Sequence CCAGGAGGGGCAGCATCTTGTCT AGAGTGCCCAAAGCATGGCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 213} {0: 1, 1: 0, 2: 0, 3: 20, 4: 174}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!