ID: 1125769636_1125769648

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1125769636 1125769648
Species Human (GRCh38) Human (GRCh38)
Location 15:42156519-42156541 15:42156554-42156576
Sequence CCAGCCACCTTGGCCAGAGTGCC GGGCAGCCCGGGCCCCAGCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 36, 4: 342} {0: 1, 1: 0, 2: 14, 3: 53, 4: 478}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!