ID: 1125770156_1125770163

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1125770156 1125770163
Species Human (GRCh38) Human (GRCh38)
Location 15:42159834-42159856 15:42159873-42159895
Sequence CCTGCCTGAGTGTCTGGTGAGCG CTCTGTGGGAACATGTATCTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 142} {0: 1, 1: 0, 2: 0, 3: 17, 4: 156}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!