ID: 1125790976_1125790985

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1125790976 1125790985
Species Human (GRCh38) Human (GRCh38)
Location 15:42365501-42365523 15:42365534-42365556
Sequence CCACCTTCCCACTTAACTCCAGA TCTCACTTGCTGATGGTGGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 261} {0: 1, 1: 0, 2: 0, 3: 20, 4: 172}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!