ID: 1125812092_1125812100

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1125812092 1125812100
Species Human (GRCh38) Human (GRCh38)
Location 15:42550156-42550178 15:42550196-42550218
Sequence CCGCGGACCACATGGGTCCTGGA GGCTTGAGCTTAAGAGATGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 95} {0: 1, 1: 1, 2: 23, 3: 320, 4: 3482}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!