ID: 1125841023_1125841030

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1125841023 1125841030
Species Human (GRCh38) Human (GRCh38)
Location 15:42801313-42801335 15:42801347-42801369
Sequence CCATGTCTTGACTGGCTAGCTGC CAGCTCAGACAGCTTGGCATTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 109} {0: 1, 1: 3, 2: 15, 3: 35, 4: 182}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!