ID: 1125898549_1125898557

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1125898549 1125898557
Species Human (GRCh38) Human (GRCh38)
Location 15:43324203-43324225 15:43324252-43324274
Sequence CCAAGTTACATGACCTAACTTGC CCTTCATTACTGAAGTTAAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 81} {0: 1, 1: 0, 2: 0, 3: 17, 4: 223}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!