|
Left Crispr |
Right Crispr |
| Crispr ID |
1125911370 |
1125911378 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
15:43442705-43442727
|
15:43442747-43442769
|
| Sequence |
CCAGGCTGGTCTCAAACTTCCGA |
CTCAGGTTCCCAAAGTGTGCTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 40, 1: 2969, 2: 53741, 3: 130480, 4: 185823} |
{0: 1, 1: 2, 2: 17, 3: 80, 4: 730} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|