ID: 1125911372_1125911378

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1125911372 1125911378
Species Human (GRCh38) Human (GRCh38)
Location 15:43442724-43442746 15:43442747-43442769
Sequence CCGACCTCAGGTGATTCACCCGC CTCAGGTTCCCAAAGTGTGCTGG
Strand - +
Off-target summary {0: 61, 1: 2148, 2: 7810, 3: 11355, 4: 11885} {0: 1, 1: 2, 2: 17, 3: 80, 4: 730}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!