ID: 1125920537_1125920547

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1125920537 1125920547
Species Human (GRCh38) Human (GRCh38)
Location 15:43522979-43523001 15:43523008-43523030
Sequence CCAGACACCCCCAGCCCAGAAGG TACCACTCCCAACCATCAGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 44, 4: 400} {0: 1, 1: 0, 2: 0, 3: 6, 4: 98}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!