ID: 1125921247_1125921257

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1125921247 1125921257
Species Human (GRCh38) Human (GRCh38)
Location 15:43527090-43527112 15:43527131-43527153
Sequence CCTGCACCCTTCTCTTGGGGCAC GGTGGCTGCAGTGCAGGAGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 23, 4: 188} {0: 1, 1: 2, 2: 7, 3: 86, 4: 913}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!