ID: 1125934003_1125934009

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1125934003 1125934009
Species Human (GRCh38) Human (GRCh38)
Location 15:43618968-43618990 15:43619001-43619023
Sequence CCCCTCAGAGAAACCCAAGGAGA TAGGAGCCAGTGATGCAGAAAGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 4, 3: 19, 4: 236} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!