ID: 1125934004_1125934009 |
View in Genome Browser |
Spacer: 9 |
Left Crispr | Right Crispr | |
---|---|---|
Crispr ID | 1125934004 | 1125934009 |
Species | Human (GRCh38) | Human (GRCh38) |
Location | 15:43618969-43618991 | 15:43619001-43619023 |
Sequence | CCCTCAGAGAAACCCAAGGAGAT | TAGGAGCCAGTGATGCAGAAAGG |
Strand | - | + |
Off-target summary | {0: 2, 1: 0, 2: 2, 3: 26, 4: 223} | No data |
Status | Not started |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer | Left Crispr | Right Crispr | ||||||
---|---|---|---|---|---|---|---|---|
Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
No off target data available for this pair! |